Repeated DNA Sequences

All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: "ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.

Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.

For example,

Given s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT",

Return:
["AAAAACCCCC", "CCCCCAAAAA"].

 public class Solution {
     public List<String> findRepeatedDnaSequences(String s) {
         List<String> list = new ArrayList<String>();
         Set<String> temp = new HashSet<String>();
         if (s == null || s.length() <= )
             return list;
         Set<String> set = new HashSet<String>();
         for (int i = ; i <= s.length(); i++) {
             if (set.contains(s.substring(i - , i))) {
                 temp.add(s.substring(i - , i));
             } else {
                 set.add(s.substring(i - , i));
             }
         }
         return new ArrayList<String>(temp);
     }
 }