1.Counting DNA Nucleotides

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of a length 21 DNA string (whose alphabet contains the symbols 'A', 'C', 'G', and 'T') is "ATGCTTCAGAAAGGTCTTACG."

Given: A DNA string ss of length at most 1000 nt.

Return: Four integers (separated by spaces) counting the respective number of times that the symbols 'A', 'C', 'G', and 'T' occur in ss.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21

# -*- coding: utf-8 -*-

@author: hyl
"""
### 2. Transcribing DNA into RNA ###
d = {'A':0,'T':0,'G':0,'C':0}
with open('C:\\Users\\hyl\\Desktop\\rosalind_dna.txt') as f:
    for line in f:
        for i in line :
            if i == "A":
                d['A'] +=1
            if i == "T":
                d['T'] +=1  
            if i == "G":
                d['G'] +=1   
            if i == "C":
                d['C'] +=1            
print str( d['A'])  + " "+str(d['C']) + " " + str(d['G']) + " " + str(d['T'])